Römer

Der Aussätzige und der Römerbrief – in einfacher SpracheGerrid Setzer Es ist kein Geheimnis, dass viele sich in unserem Land schwertun, komplexe Sätze der deutschen Sprache zu verstehen. Deshalb gibt es die Tendenz, Texte in bewusst einfacher Sprache zu verfassen. Viele Behörden tun das. Aber auch biblische Inhalte sollten von allen verstanden werden können. Deshalb wurde ein Artikel überarbeitet und in möglichst einfacher Sprache verfasst. Wer den Artikel in „normaler Sprache“ ... 08.01.2024 · Bibelstellen: Röm. 1-16; 3. Mo. 13; 14
Überblick RömerbriefGerrid Setzer Ein einfacher Überblick über den Römerbrief - mehr als "evangelistischer Leitfaden" gedacht. – 1,1-17: In der Einleitung bezeugt Paulus sein Apostelschaft und macht den Römern deutlich, warum er bisher noch nicht zu ihnen kommen konnte. Diese Hinderungsgründe führten also (vordergründig) zum Schreiben des Briefes. Vers 16 und 17 geben eine Zusammenfassung der Kernaussage dieses Teiles des Wortes Gottes: ... 04.06.2014 · Bibelstellen: Röm. 1-16
Zeugnisse GottesGerrid Setzer Gott, der Schöpfer, bezeugte sich seinen Geschöpfen, den Menschen. Wir können dabei besonders an drei Zeugnisse denken. Diese drei Zeugnisse werden in Römer 1 und 2 und 3 genannt. – 1.) Das Zeugnis der Schöpfung (Rö 1). „Denn Gottes Zorn wird vom Himmel her offenbart ... weil das von Gott Erkennbare unter ihnen offenbar ist, denn Gott hat es ihnen offenbart - denn das Unsichtbare von ihm wird geschaut, sowohl ... 01.03.2011 · Bibelstellen: Röm. 1-3
Die Frucht des Baumes – die Sünde (1)H. Forbes Witherby Wir haben keine richtige Einschätzung darüber, was Sünde in Gottes Augen ist, bevor wir das Evangelium selbst kennen. Deshalb gehen unsere Kapitel über die Gnade Gottes uns gegenüber den jetzt folgenden Kapiteln voraus, die von der Frucht und der Wurzel des Baumes – der menschlichen Natur – handeln. – Es ist wahr, der Heilige Geist lässt uns spüren, wie sehr wir Christus brauchen, bevor Er uns ... 16.03.2014 · Bibelstellen: Röm. 1,1 - 3,26
Die Frucht des Baumes – die Sünde (2)H. Forbes Witherby Kein Unterschied – Die Gnade Gottes begegnet uns genau da, wo wir sind, und begegnet allen Menschen gleich, seien es Juden oder Heiden, Philosophen oder einfache Leute. Die gesamte Rasse des Menschen ist schuldig vor Gott. „Denn es ist kein Unterschied, denn alle haben gesündigt" (Rö 3,22.23). „Gottes Gerechtigkeit aber durch Glauben an Jesus Christus gegen alle und auf alle, die glauben. Denn es ist kein Unterschied.“ ... 17.03.2014 · Bibelstellen: Röm. 1,1 - 3,26
Die Kraft des neuen Lebens (04)H. Forbes Witherby Der heiligende Geist – Der Geist Gottes in uns, durch den wir fähig sind, uns unserer Nähe zu Gott zu erfreuen, ist der „Geist der Heiligkeit“ (Rö 1,4). Sein Titel ist bedeutsamerweise der Heilige Geist. Die Liebe ist heilig. Sie bewirkt keine Leichtfertigkeit beim Nachdenken über Gott, nicht eine Spur von Respektlosigkeit. Die Liebe verleiht zwar Kühnheit, aber eine Kühnheit in uns, die passend für ... 29.09.2015 · Bibelstellen: Röm. 1,4; 1. Joh. 4,13
Er ist nicht hier, sondern er ist auferstandenDaniel Melui „Als sie aber von Furcht erfüllt wurden und das Angesicht zur Erde neigten, sprachen sie zu ihnen: Was sucht ihr den Lebendigen unter den Toten? Er ist nicht hier, sondern er ist auferstanden. Erinnert euch, wie er zu euch geredet hat, als er noch in Galiläa war, als er sagte: Der Sohn des Menschen muss in die Hände sündiger Menschen überliefert und gekreuzigt werden und am dritten Tag auferstehen.“ (Lk ... 17.04.2022 · Bibelstellen: Lk. 24,5-7; Röm. 1,4; 6,4; 1. Pet. 3,18
GlaubensgehorsamF. B. Hole Es ist beachtenswert, dass dieser Ausdruck, den wir als Überschrift gewählt haben, im Römerbrief zweimal vorkommt: Erstens in den ersten Versen in Verbindung mit dem Evangelium, mit dessen Verkündigung Paulus betraut war, und dann noch einmal in den Schlussversen des Briefes in Verbindung mit dem Geheimnis, dass er ebenfalls unter allen Nationen bekannt machen sollte. – Nun lebten die römischen Gläubigen in der ... 13.09.2008 · Bibelstellen: Röm. 1,5; 16,26
Gnade und FriedeGerrid Setzer Am Anfang eines jeden Briefes, in dem sich der Apostel Paulus als Verfasser nennt, wünscht er den Lesern Gnade und Friede. So schreibt er an die Römer: „Allen Geliebten Gottes, den berufenen Heiligen, die in Rom sind: Gnade euch und Friede von Gott, unserem Vater, und dem Herrn Jesus Christus!“ (Röm 1,7). Wir sind leicht geneigt, über solche Worte hinwegzugehen, weil sie uns vertraut vorkommen. Doch wir wollen sie ... 15.01.2020 · Bibelstellen: Röm. 1,7
Große GnadeGerrid Setzer Der Apostel Paulus konnte sich freuen über das, was Gott in anderen gewirkt hatte. Er, der durch die Gnade mehr gearbeitet hatte als alle anderen Apostel, hatte ein Blick für das Werk der Gnade in seinen Brüdern und Schwestern. Die Briefe, die er geschrieben hat, sind dafür ein beredtes Zeugnis. Wenn nur irgend möglich, fand er Worte des Lobes, der Anerkennung und der Aufmunterung für andere. Er sah das Wirken ... 03.11.2010 · Bibelstellen: Röm. 1,8
Gegenseitige ErmutigungAlexander Schneider Römer 1,11.12: „Denn mich verlangt danach, euch zu sehen ... um mit euch getröstet zu werden in eurer Mitte, ein jeder durch den Glauben, der in dem anderen ist, sowohl euren als meinen.“ – Man fragt sich: Was könnte Paulus, der langjährige Apostel, außerordentlich begabt und ausgestattet mit wichtigen Erfahrungen mit seinem Herrn, überhaupt von den jungbekehrten Römern lernen? Wenn es nach ihm ... 13.06.2023 · Bibelstellen: Röm. 1,11-12
Das Wort Gottes aufnehmenDirk Mütze Auf der zweiten Missionsreise kommen Paulus und Silas nach Beröa und gehen – wie sie es gewohnt waren – in die Synagoge der Juden, um das Wort Gottes zu predigen. Es war in Übereinstimmung mit den Gedanken Gottes, dass das Evangelium den Juden zuerst, danach den Griechen gepredigt werden sollte (Rö 1,16). – Paulus und Silas waren aus Thessalonich – dort waren sie vorher gewesen – durch den Widerstand und ... 06.12.2021 · Bibelstellen: Röm. 1,16
Das Geheimnis des EvangeliumsWilliam Gurnall So wie das Evangelium selbst ein Geheimnis des Glaubens ist, so befähigt es den Gottesfürchtigen, „merkwürdige Geheimnisse“ zu glauben – zu glauben, was sie nicht verstehen und zu hoffen, was sie nicht sehen. Es lehrt ihn zu glauben, – dass Christus zu einer bestimmten Zeit geboren wurde, und dass Er von Ewigkeit her ist; – dass Er im Mutterleib war, und dass der Himmel Himmel Ihn doch nicht fassen ... 24.09.2009 · Bibelstellen: Röm. 1,16
Es funktioniertMarco Leßmann „Denn ich schäme mich des Evangeliums nicht, denn es ist Gottes Kraft zum Heil jedem Glaubenden“ (Rö 1,16). – Ein alter Mann erzählt: „Während des Kriegs war ich Aufseher in einem Feldlazarett. Eines Nachts kam ich an das Bett eines jungen Burschen. Er sah mich mit ängstlichen Augen an und sagte: „Aufseher, ich glaube, ich muss sterben. Ich bin nicht gerettet, und ich möchte nicht so ... 22.09.2009 · Bibelstellen: Röm. 1,16
Der vielzitierte HabakukMarco Leßmann „Der Gerechte aber wird aus Glauben leben.“ Dreimal zitiert Paulus diesen Vers aus Habakuk 2,4 (wenn man davon ausgeht, dass Paulus der Schreiber auch des Hebräerbriefes ist). Und jedes Mal scheint er einen anderen Schwerpunkt legen zu wollen. Es ist ein schönes Beispiel der Vielseitigkeit des Wortes Gottes und zeigt, dass auch Paulus in der Anwendung eines Bibelverses schon mal über die ursprüngliche Bedeutung ... 10.03.2019 · Bibelstellen: Hab. 2,4; Röm. 1,17; Gal. 3,11; Heb. 10,38
Gehen alle "Unerreichten" verloren?Gerrid Setzer Seit dem Herabkommen des Heiligen Geistes am Tag der Pfingsten wird das Evangelium von Jesus Christus allen Nationen gepredigt. Doch es gibt viele, die diese wunderbare Botschaft in ihrem Leben nie gehört haben. Was ist mit diesen „Unerreichten"? Müssen sie alle verloren gehen? – Die Frage, ob alle, die das Evangelium nicht gehört haben, verloren gehen, wird zuweilen unterschiedlich beantwortet. Wir wollen uns ... 24.09.2014 · Bibelstellen: Röm. 1,19-20
Drei Wege der Offenbarung GottesDaniel Melui Der Gedanke daran, dass Gott sich völlig offenbart hat, sollte uns immer wieder mit tiefer Dankbarkeit erfüllen. Gott, der in sich selbst glückselig ist, hätte das nicht nötig gehabt. Er hätte im Verborgenen bleiben können. Aber dann hätten wir seine große Liebe nie erfahren. Wir hätten auch nie etwas von seiner überschwänglichen Gnade und reichen Barmherzigkeit gewusst. Doch Gott sei ... 19.02.2021 · Bibelstellen: Ps. 19,2; Röm. 1,20; Joh. 1,14; Heb. 1,1
TAAGTGAACTG ...Alexander Schneider TAAGTGAACTGCTTTCTAGCAACTCCTGGCTCCTTGATTGTCTTCTTAAAATCAGAAGCCACTGTATCATAAACAAACAGTAATAAACTTAGATGCTTCTTAAGTGCTTTAAACTTTGGGTTCAAATTTGAGCTGAGACTAAGACAGGTGGTGATGGTCAGAACATGTGCTTTTTATTCTTTCAGAAAATTCCCTGTCCAACTCGCCGATGAGTGCATTTTTCTCTGAGTATAGCAAAACAAACAAAACCTTTCACAAGAAATTCCACTTATGAGAAATAAAGAATGTAAGCAGACATGTTTTGGCTACAGCACTAGTTGTTAAAATACATGGGTATTCTTTCAACTGTAGTCATTCATTGACTTTACAAAAGCTGGGCCCCATTTCTTACTTCTTACGCATACACAGATTTGTATATCTAAATTTTTTAAAGTATAGCAATCTTAATAAATAGAATGAATGGCTACTGAAATATTTCAGCTAAGAGAGAGAAAATCACACGTTAATTAACTAGAATTTTATTTGTTTAAGCATACCAAGTAGGTGCTATATCTGAGAAATAAAATAAGCCCTTTTGTATATAAGAAAAAATTCCAGTGACTTTGGGCAGGAAACTAGTATTAACATTGTATTAATAGGTTGTCTTATTAGAGATCTGGATCCAATTCATCATATTTTCAGATTTAGTTAGGAATTTTTTTCTTTATCATTTATTTCCCTGAATATTTATATATAG...... – Das ist nur ein kleiner Ausschnitt aus unserer DNA! Der Mensch besitzt 23.000 Gene, mit insgesamt 3,2 Milliarden Basenpaaren. Jedes Basenpaar hat dabei die vier DNA-Bestandteile Adenin (A), Thymin (T), Guanin (G) und Cytosin (C). Insgesamt wäre ein Buch, das sie komplett enthält, mehrere hundert Meter dick! Und alles darin ist perfekt angeordnet. – Jeder Brief hat einen Absender, jeder geschriebene Text einen Autor. Da wirst du mir zustimmen. Und wie ist es bei diesem ultra-dicken Buch? – Gott kann „in dem Gemachten wahrgenommen werden –, damit sie [die Menschen] ohne Entschuldigung seien.“ (Römer 1,20) 05.03.2023 · Bibelstellen: Röm. 1,20
Paulus in AthenDirk Mütze Athen war damals eine Hochburg der Kultur und menschlicher Weisheit. Dorthin kommt nun Paulus auf seiner Reise. Als er auf die Rückkehr von Timotheus und Silas wartet, geht er durch die Stadt und ist schockiert über das Ausmaß des Götzendienstes dort. Man kann sich aufgrund der biblischen Beschreibung vorstellen, dass Götzenbilder das Straßenbild prägten, an jeder Ecke begegnete man ihnen und es gab die ... 24.11.2021 · Bibelstellen: Röm. 1,22-23; Apg. 17
Die neue ToleranzGerrid Setzer Toleranz ist ein beliebtes Schlagwort unserer Tage. Tausende haben es sich auf ihre Fahnen geschrieben. Als intolerant zu gelten, ist wohl mit das Schlimmste, was einem passieren kann. – Eine Definition des Begriffs schadet nicht: Toleranz kommt von einem lateinischen Verb, das „ertragen“, „durchstehen“, „aushalten“ und „zulassen“ bedeutet. „Toleranz […] bezeichnet allgemein das ... 10.03.2008 · Bibelstellen: Röm. 1,26-27
HomosexualitätGerrid Setzer Was sagt die Bibel zum Thema Homosexualität? Sehen wir uns einige Punkte an, die in diesem Zusammenhang immer wieder vorgebracht werden. Es geht dabei nur um Argumente, die sich auf die Bibel stützen (wollen), nicht um andere Erwägungen. – Argumente, die angeführt werden, um Homosexualität zu begründen – Gott ist Liebe und darum ist die Liebe von Gott. Auch die Liebe zwischen Mann und Mann und Frau und Frau. – ... 02.03.2012 · Bibelstellen: 3. Mo. 18,22; 20,13; 1. Mo. 19; Ri. 19; Röm. 1,26-27; 1. Kor. 6,9-11; 1. Tim. 1,9-10
Sulang mer noch am lääve sinFriedemann Werkshage (*Kölner Dialekt: Solange wir noch leben) – Karneval. Fünfte Jahreszeit. Unbekümmert feierst du, als wär’s das letzte Mal; als gäbe es keinen Morgen mehr. Keine Tabus. Keine Grenzen. Keine Moral. Nur das Heute zählt. Von Konsequenzen lässt du dich jetzt nicht bremsen. Jetzt wird gefeiert, was das Zeug hält! Was morgen kommt, das sieht man dann. – Zwar kann man mit den Konsequenzen einer wilden, ... 19.02.2019 · Bibelstellen: Apg. 3,19; 17,30; Jes. 55,7; Röm. 2,5
Das Gewissen und der Hund Stellen Sie sich einen Hausherrn vor, dessen Haus von Einbrechern bedroht ist und der, statt sich um die Gefahr zu kümmern, seinen bellenden Hund erschießt, nur um wieder ungestört schlafen zu können! So töricht handeln wir Menschen, wenn wir die Stimme unseres Gewissens zum Schweigen bringen, anstatt auf diesen Mahner Gottes zu hören. – Gott hat den Menschen die Ewigkeit in ihr Herz gelegt (Prediger 3, 11), hat ... 09.05.2009 · Bibelstellen: Röm. 2,15
Prediger sind wie Straßenschilder ...Gerrid Setzer Eine Frau, die mit dem Christentum nichts am Hut hatte, fasste ihre Erfahrungen mit den Verkündigern der guten Botschaft einmal wie folgt zusammen: – Prediger sind wie Straßenschilder. Sie zeigen den Weg, aber sie gehen ihn nicht. – Ein bitteres Wort! Aber können wir verleugnen, dass wir Menschen Anlass gegeben haben, so zu denken und so zu sprechen? – Wir reden von unserer himmlischen Hoffnung und doch ist unser Leben sehr ... 27.03.2010 · Bibelstellen: Röm. 2,17-24
Der Blick in den Spiegel Zwei Männer arbeiten zusammen auf dem Bau. Der eine hat ein sauberes Gesicht, der andere ein schmutziges. Als sich beide begegnen, schauen sie sich an. Der, der ein sauberes Gesicht hat, geht hin und wäscht sich, weil er denkt, dass er bestimmt so schmutzig wie der andere geworden ist. Der Schmutzige wäscht sich nicht, weil er denkt, er sei so rein wie sein Kumpel. Als sie einige Zeit später in einen Spiegel schauen, erfahren ... 31.08.2022 · Bibelstellen: Röm. 3,10-18
Edel, hilfreich und gut?Gerrid Setzer Unter der berühmten nach ihm benannten Goethe-Eiche auf dem Ettersberg bei Weimar soll der große Dichter einst die bekannten Worte geschrieben haben: „Edel sei der Mensch, hilfreich und gut.“ Doch genau auf diesem Gelände, um die Goethe-Eiche herum, bauten die Nazis später das KZ Buchenwald. Die Goethe-Eiche wurde im Krieg beschädigt und später abgesägt. Der Stumpf aber ist geblieben und erinnert ... 10.07.2013 · Bibelstellen: Röm. 3,10-12
Goethe-Eiche in BuchenwaldGerrid Setzer Edel sei der Mensch, – hilfreich und gut! – Denn das allein – unterscheidet ihn – von allen Wesen, – die wir kennen. – Das schrieb bekanntlich Goethe. Und wo schrieb er diese Zeilen? Vielleicht unter jener Eiche, die später Goethe-Eiche genannt wurde. – Da, wo die „Goethe-Eiche“ steht, wurde später das KZ Buchenwald errichtet. Heute kann der Baumstumpf in Buchenwald noch besehen werden. – Und in dem ... 01.03.2017 · Bibelstellen: Röm. 3,11-12
Wie gut ist gut genug?Friedemann Werkshage Viele Menschen heute denken, dass man sich durch gute Taten den Himmel verdienen kann. Je mehr, desto besser. Gott wird schon damit zufrieden sein. Das Konzept hört sich erst einmal ganz einfach an. Jeden Tag eine gut Tat, vielleicht auch einmal zwei, dann klappt’s schon. Also, los geht’s! – Doch irgendwie scheint sich die Sache doch schwieriger zu gestalten als gedacht. Was ist eigentlich „gut“? Wer bestimmt das? ... 31.01.2014 · Bibelstellen: Röm. 3,12
Mahlzeit!Gerrid Setzer Deutschland 12.00 Uhr. Kollegen und Kolleginnen rufen sich "Mahlzeit" zu, wenn sie in die Mittagspause gehen. "Mahlzeit" - eigentlich ein ungewöhnlicher Ausdruck. Es scheint ihm etwas zu fehlen. Und tatsächlich war es früher wohl üblich "Gott segne die Mahlzeit" zu sagen. Später erst ging man dazu über, sich lediglich eine "Gesegnete Mahlzeit" zu wünschen. Dann ist auch das "Gesegnete" weggefallen, und heute ... 28.07.2011 · Bibelstellen: Röm. 3,18
Gottes GerechtigkeitFriedemann Werkshage Alle Menschen sind Sünder und können deswegen niemals die Herrlichkeit Gottes erreichen (Rö 3,23; 7,7f). Wenn wir den vollkommenen Maßstab Gottes, das Gesetz, einmal an uns halten, dann erkennen wir unsere Sünden sehr schnell. Das Gesetz überführt uns alle, es lässt uns völlig schuldig dastehen (vgl. Rö 3,19.20). „Da ist kein Gerechter, auch nicht einer..., da ist keiner der Gutes tut, da ist auch ... 04.10.2014 · Bibelstellen: Röm. 3,19-26
Gegen alle und auf alleDaniel Melui „Gottes Gerechtigkeit aber durch Glauben an Jesus Christus gegen alle und auf alle, die glauben“ (Röm 3,22). – In diesem Vers begegnet uns eine Ausdrucksweise des Apostels, die uns auf den ersten Blick vielleicht etwas schwer verständlich erscheint. Er spricht von „Gottes Gerechtigkeit … gegen alle und auf alle, die glauben“. Was meint er damit? – „Gegen alle“ – Dieser Ausdruck zeigt uns ... 03.12.2018 · Bibelstellen: Röm. 3,22
Das Spiel deines LebensFriedemann Werkshage Das Spiel deines Lebens – „Nach fünf Minuten ist das Spiel dann für diesen Stürmer vorbei. Rot für dieses aggressive Foul. Der Schiri hat ein genaues Auge. Jetzt wilde Diskussionen. Doch es bleibt bei der Entscheidung.“ So ähnlich werden wir es auch bei der WM 2018 in Russland sicher öfters hören. Es ist wohl die wichtigste Aufgabe des Schiedsrichters, darauf zu achten, dass die Spielregeln ... 07.06.2018 · Bibelstellen: Röm. 3,23; 6,23; Joh. 3,16; 1. Joh. 1,9
Das verlorene ParadiesFriedemann Werkshage Fassungslos stehen die Menschen vor der größten Katastrophe ihres Lebens. Was so fern schien, war plötzlich lebensbedrohlich nahe gekommen. Unerbittlich und schonungslos war die Feuerwalze über „Paradise“, einer Kleinstadt im Bundesstaat Kalifornien, USA, hinweggerollt und hat einen ganzen Ort in Schutt und Asche gelegt. Straßen und Zufahrten sind durch den noch immer aufsteigenden Qualm zu erkennen. Doch ... 18.11.2018 · Bibelstellen: Lk. 9,25; 12,20-21; Joh. 3,16; Röm. 3,23; 6,23; 1. Joh. 1,9
Das Wunder von ChileFriedhelm König Nach Gold und Kupfer schürfen sie. In 688 Metern Tiefe. Dann stürzt ihr Stollen mit Urgewalt ein, und für die 33 Bergarbeiter ist jeder Ausweg versperrt. Seit an jenem 5. August 2010 das Grubenunglück passiert ist, campieren die Angehörigen der Verschütteten im Lager „Esperanza" nahe der Unglücksmine San José. Hier in Chiles Atacama-Wüste ist man weit weg von Chiles Zentren. Santiago de Chile, ... 05.08.2012 · Bibelstellen: Röm. 3,23
Einstellungstest Alle haben gesündigt und erreichen nicht die Herrlichkeit Gottes und werden umsonst gerechtfertigt durch seine Gnade, durch die Erlösung, die in Christus Jesus ist. (Römer 3,23.24) – Noch eine Frage, dann hat Marvin es geschafft. Er muss sich konzentrieren: „Die Bundesrepublik Deutschland besteht aus …“ Das hat Marvin zum Glück auswendig gelernt! Es sind 16 Bundesländer. Schleswig Holstein, Hamburg, ... 25.04.2014 · Bibelstellen: Röm. 3,23-24
Gedanken zum Thema SündeJohn Nelson Darby Eine einzige Sünde ist vor Gott schrecklicher, als es für uns tausend Sünden sind, ja selbst als alle Sünden in der Welt. – Gott kann nichts durchgehen lassen. Er kann alles vergeben und kann von allem reinigen, aber Er lässt nichts durchgehen. – Wenn alle Sünden, die je in der Welt begangen wurden, bei dir zusammenkämen und von dir selbst begangen worden wären, brauchte dich das doch nicht davon ... 28.10.2019 · Bibelstellen: Röm. 3,23
Gott kann mehr als der US-PräsidentAlexander Schneider „Alle haben gesündigt [...] und werden umsonst gerechtfertigt durch seine Gnade, durch die Erlösung, die in Christus Jesus ist.“ (Römer 3,23.24) – 2017 sollte der Sheriff Joe Arpaio wegen Diskriminierung von Migranten ins Gefängnis kommen. Doch US-Präsident Donald Trump machte von seinem Recht als Präsident Gebrauch, Menschen begnadigen zu dürfen. Somit bewahrte er Arpaio vor einer Haftstrafe. – ... 07.03.2023 · Bibelstellen: Röm. 3,23-24
Drei Aspekte der RechtfertigungMarco Leßmann Im Römerbrief finden wir den Gedanken der Rechtfertigung unter drei verschiedenen Aspekten. – Wir sind gerechtfertigt … – … durch Gottes Gnade (Rö 3,24)… aus Glauben (Rö 3,26; 5,1) und… durch das Blut Christi (Rö 5,9). – Die Gnade war das Motiv im Herzen Gottes, das ihn bewog, Sünder zu rechtfertigen. Der Anfang des Römerbriefes macht sehr deutlich, dass jeder Mensch, ob Jude oder Heide, ob ... 05.04.2014 · Bibelstellen: Röm. 3,24.26; 5,1.9
Gegensätze - Einst vs. Jetzt (8)Alexander Schneider „Denn es hat ja Christus einmal für Sünden gelitten, der Gerechte für die Ungerechten.“1. Pet 3,18 – „Wir werden umsonst gerechtfertigt durch seine Gnade, durch die Erlösung, die in Christus Jesus ist.“ Röm 3,24 – Gegensätze (8) – ungerecht & gerechtfertigt – Viele Menschen wollen es nicht wahrhaben, da sie versuchen, ein rechtschaffenes und ordentliches Leben zu führen ... 14.04.2022 · Bibelstellen: 1. Pet. 3,18; Röm. 3,24
RechtfertigungOliver Kemmann Die Rechtfertigung vor Gott ist ein wichtiges Thema. In Römer 3,24 finden wir, dass wir nichts zu unserer Rechtfertigung beitragen können. Es ist reine Gnade, dass wir durch den Tod und die Auferstehung des Herrn Jesus jetzt als gerecht vor Gott stehen können. – Durch Anklicken der Fragen auf der linken Seite der Infografik werden die Ausdrücke in dem Bibelvers markiert, die Antwort auf die folgenden Fragen geben: – Was ist ... 22.03.2024 · Bibelstellen: Röm. 3,24 Interaktiv
Unterschied zwischen erkaufen und erlösenBruce Anstey Erkauftsein ist allgemein, Erlösung ist, wenn sie sich auf Personen bezieht, individuell. Sie bezieht sich auf eine spezielle Klasse – auf solche, die Christus im Glauben als ihren Erretter angenommen haben. – Ein oder zwei Illustrationen mögen uns helfen, den Unterschied zwischen diesen beiden Dingen zu verstehen. Stell dir vor, du siehst einen eingesperrten Hund, gefangen gehalten von einem brutalen Herrn. Oft gehst du an ... 11.05.2019 · Bibelstellen: 2. Pet. 2,1; Röm. 3,24
Den Gott dargestellt hat zu einem SühnmittelEdward Dennett „… den Gott dargestellt hat zu einem Sühnmittel durch den Glauben an sein Blut“ (Rö 3,25). – Das Wort, das hier mit „Sühnmittel“ übersetzt wurde, müsste ohne Zweifel „Sühndeckel“ heißen. Es ist dasselbe Wort wie in Hebräer 9,5, wo es so übersetzt ist. Das erklärt den Ausdruck „dargestellt“. In der Stiftshütte war der Sühndeckel ... 29.03.2017 · Bibelstellen: Röm. 3,25
Der SühndeckelMarco Leßmann Römer 3,25 ermächtigt uns eindeutig dazu, in dem Deckel der Bundeslade ein Bild von Christus zu sehen. Mindestens in dreifacher Hinsicht weist der Sühndeckel auf Christus hin: – Der Deckel war „aus reinem Gold“ (2. Mo 25,17): Gold ist ein Hinweis auf göttliche Herrlichkeit und Gerechtigkeit. Der Herr Jesus ist eine göttliche Person – Gott offenbart im Fleisch. Hier sehen wir also die Herrlichkeit seiner ... 24.11.2009 · Bibelstellen: Röm. 3,25
Ein vollbrachtes WerkMarco Leßmann „Es ist vollbracht!“ (Joh 19,30). Es gibt wohl keinen Satz in der gesamten Menschheitsgeschichte, der von größerer Tragweite wäre, als der, den der Heiland am Kreuz ausrief, kurz bevor Er sein Leben in den Tod gab. Der Herr Jesus drückte damit sein göttliches Siegel unter ein vollbrachtes Erlösungswerk. Dieses Werk am Kreuz teilt die Zeit gemäß Römer 3,25.26 in die Zeit ... 13.12.2022 · Bibelstellen: Joh. 19,30; Röm. 3,25-26
Die Ergebnisse der RechtfertigungFriedemann Werkshage Viele Christen haben ein aufrichtiges Verlangen in ein „richtiges Verhältnis zu Gott“ zu kommen. Sie haben einmal Gottes Urteil über sich anerkannt und glauben an den Herrn Jesus als ihren Retter. Und jetzt bemühen sie sich aufrichtig, ein hingebungsvolles Leben für Gott zu führen. Und dennoch fühlen sie sich nicht errettet. Sie sehen viel Unzulänglichkeit, Sünde und Untreue in ihrem Leben und ... 01.04.2020 · Bibelstellen: Röm. 3,26
Fragen und Antworten (45) - Anfänger und Vollender des GlaubensEmil Dönges Frage: Was bedeutet der Titel „Anfänger und Vollender des Glaubens“ in Hebräer 12,2? Kann man Römer 3,22 und 26 hiermit in Verbindung bringen? Antwort: Der Herr Jesus heißt Anfänger (Vorgänger) und Vollender des Glaubens, weil Er selbst einst in dieser armen und argen Welt im Glauben und nicht durch Schauen wandelte und mit Ausharren auf das herrliche Ziel Seines schwierigen Weges blickte. In ... 27.06.2017 · Bibelstellen: Heb. 12,2; Röm. 3,22.26
Gottes GerechtigkeitFriedemann Werkshage 2017 sollte der amerikanische Sheriff Joe Arpaio wegen Diskriminierung von Migranten ins Gefängnis kommen. Doch US-Präsident Donald Trump machte von seinem Recht als Präsident Gebrauch, Menschen begnadigen zu dürfen. Somit bewahrte er Arpaio vor einer Haftstrafe. Was sich dadurch jedoch nicht änderte, war die Schuldhaftigkeit des eigentlich Verurteilten. Arpaio war weiterhin der Gesetzesverstöße schuldig! ... 30.03.2020 · Bibelstellen: Röm. 3,26
Im Himmel gibt's keine AngeberChristopher Knapp David und seine Männer waren eine Zeit lang von zu Hause fort gewesen. Als sie zurückkommen, finden sie zu ihrer Überraschung und Bestürzung ihre Stadt niedergebrannt, ihren Besitz gestohlen und - was das Schlimmste ist - ihre Frauen und Kinder verschleppt. Nachdem sie sich etwas von dem Schock erholt haben, beginnen sie die Verfolgung der amalekitischen Eindringlinge. Sie finden einen halb verhungerten, allein gelassenen ... 16.09.2012 · Bibelstellen: 1. Sam. 30,15; Eph. 2,8-10; Röm. 3,27-28